Sequence 1268(XLOC 022286 , XLOC022286)

From Wikisequences
Jump to: navigation, search
Sequence XLOC_022286 , XLOC022286
Target XLOC_022286 ( Nicotiana benthamiana )
Description
Design primer set
Chemistry DNA
Sequence Forward PCR primer (21b) CACAAGATATGAATCGCCCTT / Reverse PCR primer (20b) TCTCCATCCTGCAAAACCTC
Application gene expression
Name XLOC_022286 , XLOC022286

References

Deep sequencing-based transcriptome profiling reveals comprehensive insights into the responses of Nicotiana benthamiana to beet necrotic yellow vein virus infections containing or lacking RNA4.Fan H, Sun H, Wang Y, Zhang Y, Wang X, Li D, Yu J, Han C.PLoS One. 2014 Jan 9;9(1) :e85284. doi: 10.1371/journal.pone.0085284. eCollection 2014.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Comments

Background

Support Doctors Without Borders