Sequence 1272(XLOC 024875 , XLOC024875)
From Wikisequences
Sequence XLOC_024875 , XLOC024875 | |
---|---|
Target | XLOC_024875 ( Nicotiana benthamiana ) |
Description | |
Design | primer set |
Chemistry | DNA |
Sequence | Forward PCR primer (22b) AATTCCGTGGATTCCTAGCCAA / Reverse PCR primer (22b) AGGCTCGAAAACAGAGTTCACA |
Application | gene expression |
Name | XLOC_024875 , XLOC024875 |
References
Deep sequencing-based transcriptome profiling reveals comprehensive insights into the responses of Nicotiana benthamiana to beet necrotic yellow vein virus infections containing or lacking RNA4.Fan H, Sun H, Wang Y, Zhang Y, Wang X, Li D, Yu J, Han C.PLoS One. 2014 Jan 9;9(1) :e85284. doi: 10.1371/journal.pone.0085284. eCollection 2014.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478