Sequence 1276(XRN1)

Sequence XRN1
Target	XRN1 ( Homo sapiens )
Description	5'-3' exoribonuclease 1 Ensembl: ENSG00000114127 UniGene: Hs.435103 EntrezGene: 54464 Ensembl Chr3: 143508139 - 143649543 Strand: -1 GO terms: 0003676 0003677 0003723 0003725 0004527 0005622 0005737 0007049 0016787 0045786
Design	siRNA
Chemistry	RNA
Sequence	siRNA sense (21b) GGTGTTGTTTCGCATTATTTT / siRNA antisense (21b) AATAATGCGAAACAACACCTT
Application	gene silencing
Name	XRN1

References

SMG7 acts as a molecular link between mRNA surveillance and mRNA decay.Unterholzner L, Izaurralde E.Mol Cell. 2004 Nov 19;16(4) :587-96.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background

Gene Function. Bashkirov et al. (1997) characterized mouse Sep1. Both Sep1 variants were active in yeast complementation assays. The longer variant exhibited 5-prime-to-3-prime exoribonuclease activity. Sep1 showed substrate preference for RNA G4 tetraplex-containing substrates over a monomeric RNA substrate with the same sequence. It also preferred RNA substrates over DNA substrates, either G4 or monomeric. Immunostaining revealed endogenous SEP1 expressed in several human and murine cells as diffuse cytoplasmic staining and an enrichment in cytoplasmic foci. Microtubule depolymerizing agents abolished the diffuse cytoplasmic localization but not the localization in foci. Ingelfinger et al. (2002) determined that, in addition to SEP1, these foci contain RNA-decapping enzyme (DCP1/2) and several LSM proteins (see 607281).

Zhang et al. (2002) determined that SEP1 was downregulated in 3 of 4 osteogenic sarcoma cell lines and in 8 of 9 osteogenic sarcoma biopsy specimens. Animal Model.Gatfield and Izaurralde (2004) showed that, contrary to expectation, degradation of premature termination codon (PTC)-containing messages in Drosophila is initiated by endonucleolytic cleavage(s) in the vicinity of the nonsense codon. The resulting 5-prime fragment is rapidly degraded by exonucleolytic digestion by the exosome, whereas the 3-prime fragment is degraded by Xrn1. This decay route is shown for several PTC-containing reporters, as well as an endogenous mRNA that is naturally regulated by nonsense-mediated mRNA decay (NMD). Gatfield and Izaurralde (2004) concluded that despite conservation in the NMD machinery, PTC-containing transcripts are degraded in Drosophila by a mechanism that differs considerably from those described in yeast and mammals.