Sequence 1279(hYAP)
From Wikisequences
Sequence hYAP | |
---|---|
Target | YAP1 ( Homo sapiens ) |
Description | Yes-associated protein 1, 65kDa
Ensembl: ENSG00000118181 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) GACATCTTCTGGTCAGAGATT / siRNA antisense (21b) TCTCTGACCAGAAGATGTCTT |
Application | gene silencing |
Name | hYAP |
References
Akt phosphorylates the Yes-associated protein, YAP, to induce interaction with 14-3-3 and attenuation of p73-mediated apoptosis.Basu S, Totty NF, Irwin MS, Sudol M, Downward J.Mol Cell. 2003 Jan;11(1) :11-23.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478