Sequence 1280(siYWHAZ.2)
From Wikisequences
| Sequence siYWHAZ.2 | |
|---|---|
| Target | YWHAZ (Homo sapiens) |
| Description | Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide
Ensembl: ENSG00000119950 UniGene: Hs.492407 EntrezGene: 7534 Ensembl Chr10: 111957353 - 112037113 Strand: 1 GO terms: 0003677 0003714 0005634 0005737 0006355 0008285 0030528 0042994 0045449 |
| Design | siRNA |
| Chemistry | RNA |
| Sequence | siRNA sense (21b) GGTTTATGTTACTTCTATTTT / siRNA antisense (21b) AATAGAAGTAACATAAACCTG |
| Application | gene silencing |
| Name | siYWHAZ.2 |
References
Multiplexing siRNAs to compress RNAi-based screen size in human cells. Martin SE, Jones TL, Thomas CL, Lorenzi PL, Nguyen DA, Runfola T, Gunsior M, Weinstein JN, Goldsmith PK, Lader E, Huppi K, Caplen NJ. Nucleic Acids Res. 2007;35(8):e57.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
