Sequence 1283(EWS/FLI-1 3 , EWS/FLI13)
| Sequence EWS/FLI-1_3 , EWS/FLI13 | |
|---|---|
| Target | ZFP36L1 ( Homo sapiens ) |
| Description | Zinc finger protein 36, C3H type-like 1
Ensembl: ENSG00000185650 UniGene: Hs.85155 EntrezGene: 677 Ensembl Chr14: 68325077 - 68331206 Strand: -1 GO terms: 0000288 0001570 0003676 0003700 0003729 0005515 0005634 0005737 0005829 0006402 0006417 0008270 0043488 0046872 |
| Design | siRNA |
| Chemistry | RNA |
| Sequence | siRNA sense (21b) GAATACAGAGCAACGGCCCTT / siRNA antisense (21b) GGGCCGTTGCTCTGTATTCTT |
| Application | gene silencing |
| Name | EWS/FLI-1_3 , EWS/FLI13 |
References
Targeting of EWS/FLI-1 by RNA interference attenuates the tumor phenotype of Ewing's sarcoma cells in vitro.Chansky HA, Barahmand-Pour F, Mei Q, Kahn-Farooqi W, Zielinska-Kwiatkowska A, Blackburn M, Chansky K, Conrad EU 3rd, Bruckner JD, Greenlee TK, Yang L.J Orthop Res. 2004 Jul;22(4) :910-7.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
Gene Function. Ning et al. (1996) found that BERG36 could be induced by treatment with calcium ionophore, and the induction could be blocked by treatment with interleukin-4 (IL4; 147780), but not by CD40 (109535) ligation. Treatment of the Epstein-Barr virus-negative human Burkitt lymphoma cell line Ramos, which phenotypically resembles germinal center B cells, with BERG36-antisense or with IL4 or CD40 ligation protected the cells from ionophore-induced apoptosis. CD40 ligation also protected Ramos cells from apoptosis induced by inhibitors of macromolecular synthesis. Ning et al. (1996) concluded that BERG36 is a target of IL4 signaling for B-cell survival.
Vignudelli et al. (2010) found that ZFP36L1 was expressed in all human hematopoietic lineages except the erythroid lineage. Overexpression of ZFP36L1 in human CD34 (142230)-positive cord blood-derived stem/progenitor cells inhibited their erythroid differentiation and colony formation, which appeared to be due to downregulation of STAT5B (604260) protein levels through degradation of STAT5B mRNA. Overexpression of ZFP36 (190700) also inhibited erythroid differentiation, and overexpression of both ZFP36 and ZFP36L1 had a cumulative effect. Both ZFP36 and ZFP36L1 directly bound a canonical AU-rich element II in the 3-prime UTR of STAT5B mRNA. Overexpression of ZFP36L1 also increased expression of IRF8 (601565), a transcription and proapoptotic factor expressed in myeloid and lymphoid lineages, but not in erythroid lineage. Vignudelli et al. (2010) concluded that ZFP36L1 negatively regulates erythroid differentiation by interfering with the STAT5B pathway in human hematopoietic stem cells.
Animal Model. Stumpo et al. (2004) found that all Zfp36l1 knockout mouse embryos died in utero, most by about embryonic day 11. Failure of chorioallantoic fusion occurred in about two-thirds of cases. Even when fusion occurred, the affected placentas exhibited decreased cell division and relative atrophy of the trophoblast layers. Embryonic expression of Zfp36l1 at embryonic day 8.0 was greatest in the allantois, consistent with a role for Zfp36l1 in chorioallantoic fusion. Stumpo et al. (2004) concluded that lack of Zfp36l1 expression during midgestation results in abnormal stabilization of mRNAs whose encoded proteins cause abnormal placentation and fetal death.
