Sequence 145 (CLSTR05609r1 cieg008e21 127)
From Wikisequences
Sequence CLSTR05609r1_cieg008e21_127 | |
---|---|
Target | AK116796 ( Ciona intestinalis ) |
Description | |
Design | morpholino |
Chemistry | pmCpmTpmCpmApmTpmCpmTpmGpmApmGpmApmTpmApmApmTpmTpmTpmTpmGpmApmTpmTpmTpmTpmT |
Sequence | (25b) CTCATCTGAGATAATTTTGATTTTT |
Application | gene silencing |
Name | CLSTR05609r1_cieg008e21_127 |
References
Morpholino-based gene knockdown screen of novel genes with developmental function in Ciona intestinalis.Yamada L, Shoguchi E, Wada S, Kobayashi K, Mochizuki Y, Satou Y, Satoh N.Development. 2003 Dec;130(26) :6485-95. Epub 2003 Nov 19.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478