Sequence 156 (siAKT3.2)
From Wikisequences
Sequence siAKT3.2 | |
---|---|
Target | AKT3 (Homo sapiens) |
Description | V-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma)
Ensembl: ENSG00000117020 UniGene: Hs.498292 EntrezGene: 10000 Ensembl Chr1: 241718158 - 242080053 Strand: -1 GO terms: 0000166 0004672 0004674 0004713 0005515 0005524 0005737 0006468 0007165 0016020 0016740 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) GCAGCTCCAACTTATATAATT / siRNA antisense (21b) TTATATAAGTTGGAGCTGCGT |
Application | gene silencing |
Name | siAKT3.2 |
References
Multiplexing siRNAs to compress RNAi-based screen size in human cells. Martin SE, Jones TL, Thomas CL, Lorenzi PL, Nguyen DA, Runfola T, Gunsior M, Weinstein JN, Goldsmith PK, Lader E, Huppi K, Caplen NJ. Nucleic Acids Res. 2007;35(8):e57.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478