Sequence 169 (SP-1271 , SP1271)
From Wikisequences
Sequence SP-1271 , SP1271 | |
---|---|
Target | ALPP ( Homo sapiens ) |
Description | Alkaline phosphatase, placental ( Regan isozyme )
Ensembl: ENSG00000163283 UniGene: Hs.284255 EntrezGene: 250 Ensembl Chr2: 232951592 - 232955841 Strand: 1 GO terms: 0000287 0004035 0008152 0008270 0009986 0016020 0016021 0016787 0048503 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) CGGATGTTACCGAGAGCGATT / siRNA antisense (21b) TCGCTCTCGGTAACATCCGTT |
Application | gene silencing |
Name | SP-1271 , SP1271 |
References
Functional siRNAs and miRNAs exhibit strand bias.Khvorova A, Reynolds A, Jayasena SD.Cell. 2003 Oct 17;115(2) :209-16. Cell. 2003 Nov 14;115(4) :505.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478