Sequence 171 (SP-2217 , SP2217)
From Wikisequences
| Sequence SP-2217 , SP2217 | |
|---|---|
| Target | ALPP ( Homo sapiens ) |
| Description | Alkaline phosphatase, placental ( Regan isozyme )
Ensembl: ENSG00000163283 UniGene: Hs.284255 EntrezGene: 250 Ensembl Chr2: 232951592 - 232955841 Strand: 1 GO terms: 0000287 0004035 0008152 0008270 0009986 0016020 0016021 0016787 0048503 |
| Design | siRNA |
| Chemistry | RNA |
| Sequence | siRNA sense (21b) GTGATGTATGTCAGAGAGTTT / siRNA antisense (21b) ACTCTCTGACATACATCACTT |
| Application | gene silencing |
| Name | SP-2217 , SP2217 |
References
Functional siRNAs and miRNAs exhibit strand bias.Khvorova A, Reynolds A, Jayasena SD.Cell. 2003 Oct 17;115(2) :209-16. Cell. 2003 Nov 14;115(4) :505.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
