Sequence 189 (APH-1 , APH1)

Sequence APH-1 , APH1
Target	APH1A ( Homo sapiens )
Description	Anterior pharynx defective 1 homolog A ( C. elegans ) Ensembl: ENSG00000117362 UniGene: Hs.108408 EntrezGene: 51107 Ensembl Chr1: 148502512 - 148508156 Strand: -1 GO terms: 0005515 0005783 0005794 0005887 0006509 0007220 0016020 0016021 0016485 0031293 0042987 0043085
Design	siRNA
Chemistry	RNA
Sequence	siRNA sense (21b) GAAGGCAGATGAGGGGTTATT / siRNA antisense (21b) TAACCCCTCATCTGCCTTCTT
Application	gene silencing
Name	APH-1 , APH1

References

Effects of RNA interference-mediated silencing of gamma-secretase complex components on cell sensitivity to caspase-3 activation.Xie Z, Romano DM, Kovacs DM, Tanzi RE.J Biol Chem. 2004 Aug 13;279(33) :34130-7. Epub 2004 Jun 7.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background

Description. APH1 is a multipass transmembrane protein that interacts with presenilin (see PSEN1; 104311) and nicastrin (APH2; 605254) as a functional component of the gamma-secretase complex. The gamma-secretase complex is required for the intramembrane proteolysis of a number of membrane proteins, including the amyloid-beta precursor protein (APP; 104760) and Notch (190198).Gene Function. Goutte et al. (2002) showed that C. elegans embryos with mutations in the Aph1 gene lacked the anterior pharynx but could develop a relatively normal posterior pharynx, a phenotype similar to that associated with mutations in Notch pathway components. After analyzing Aph1 mutant embryos, they concluded that Aph1 and presenilins are required for cell surface localization of the Notch component Aph2 (nicastrin).

By analyzing C. elegans mutant phenotypes, Francis et al. (2002) determined that Aph1 and Pen2 were required for Glp1/Notch-mediated signaling, both in embryonic patterning and in postembryonic germline proliferation. They observed that the human APH1 and PEN2 genes partially rescued the C. elegans mutant phenotypes, demonstrating conserved functions. Human APH1 and PEN2 had to be provided together to rescue the mutant phenotypes, and inclusion of PSEN1 improved rescue. Francis et al. (2002) concluded that APH1 and PEN2 cooperate closely in the same process to promote presenilin activity. Using RNA-mediated interference assays to inactivate Aph1, Pen2, or nicastrin in cultured Drosophila cells, Francis et al. (2002) observed reduction in gamma-secretase cleavage of beta-APP and Notch substrates and reduction in the levels of processed presenilin. They concluded that APH1 and PEN2 are required for Notch pathway signaling, gamma-secretase cleavage of beta-APP, and presenilin protein accumulation. In a commentary, Goutte (2002) discussed the contribution of Francis et al. (2002) to current understanding of how presenilins mediate the gamma-secretase cleavage of Notch transmembrane receptors and transmembrane beta-APP.

Using coimmunoprecipitation and nickel affinity pull-down approaches, Lee et al. (2002) showed that mammalian APH1A and APH1B physically associated with nicastrin and presenilin heterodimers in vivo. Inactivation of endogenous APH1 using small interfering RNAs resulted in decreased presenilin levels, accumulation of gamma-secretase substrates, and reduction of gamma-secretase products. Lee et al. (2002) hypothesized that APH1 is a functional component of the gamma-secretase complex required for the intramembrane proteolysis of APP and Notch.