Sequence 190 (siAPJ)

Sequence siAPJ
Target	APLNR ( Homo sapiens )
Description	Apelin receptor Ensembl: ENSG00000134817 UniGene: Hs.690560 EntrezGene: 187 Ensembl Chr11: 56757630 - 56761302 Strand: -1 GO terms: 0001584 0004872 0004930 0004945 0004947 0004982 0004992 0005886 0005887 0006935 0007165 0007186 0016021 0016493 0045028
Design	siRNA
Chemistry	RNA
Sequence	siRNA sense (21b) GGTGCAGTGCTACATGGACTT / siRNA antisense (21b) GTCCATGTAGCACTGCACCTT
Application	gene silencing
Name	siAPJ

References

Inhibition of HIV-1 fusion with small interfering RNAs targeting the chemokine coreceptor CXCR4.Zhou N, Fang J, Mukhtar M, Acheampong E, Pomerantz RJ.Gene Ther. 2004 Dec;11(23) :1703-12.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background

Gene Function. Tatemoto et al. (1998) stated that apelin (300297) is an endogenous ligand for the APJ receptor.

Cayabyab et al. (2000) reported that in addition to the chemokine receptors CCR5 (601373) and CXCR4 (162643), primary HIV-1 isolates can also use APJ as a coreceptor. CAT reporter assays showed that synthetic apelin peptides inhibited HIV-1 entry into CD4 (186940)-APJ-expressing cells.

Using cDNA microarray analysis on paired samples of left ventricle obtained before and after placement of a left ventricular assist device in 11 patients, Chen et al. (2003) found that APJ was the most significantly upregulated gene. Using immunoassay and immunohistochemical techniques, they demonstrated that apelin is localized primarily in the endothelium of the coronary arteries and is found at a higher concentration in cardiac tissue after mechanical offloading. The authors also demonstrated increases in the plasma level of apelin in patients with left ventricular dysfunction. Chen et al. (2003) concluded that their findings imply an important apelin-APJ paracrine signaling pathway in the heart.

Scimia et al. (2012) reported that genetic loss of APJ, a G protein-coupled receptor, confers resistance to chronic pressure overload by markedly reducing myocardial hypertrophy and heart failure. In contrast, mice lacking apelin, the endogenous APJ ligand, remain sensitive, suggesting an apelin-independent function of APJ. Freshly isolated APJ-null cardiomyocytes exhibit an attenuated response to stretch, indicating that APJ is a mechanosensor. Activation of APJ by stretch increases cardiomyocyte cell size and induces molecular markers of hypertrophy. Whereas apelin stimulates APJ to activate G-alpha-i (see 139310) and elicits a protective response, stretch signals in an APJ-dependent, G protein-independent fashion to induce hypertrophy. Stretch-mediated hypertrophy is prevented by knockdown of beta-arrestins (e.g., 107940) or by pharmacologic doses of apelin acting through G-alpha-i. Scimia et al. (2012) concluded that, taken together, their data indicated that APJ is a bifunctional receptor for both mechanical stretch and the endogenous peptide apelin. By sensing the balance between these stimuli, APJ occupies a pivotal point linking sustained overload to cardiomyocyte hypertrophy.

Pauli et al. (2014) studied the relationship between Toddler (also known as Apela/Elabela/Ende, 615594) and APJ/apelin receptors through genetic interaction and receptor internalization experiments. Loss or overproduction of Toddler reduced cell movements during zebrafish gastrulation; mesodermal and endodermal cells were slow to internalize and migrate. Both the local and ubiquitous expression of Toddler were able to rescue gastrulation movements in Toddler mutants, suggesting that Toddler acts as a motogen, a signal that promotes cell migration. Toddler activates G protein-coupled APJ/apelin receptor signaling, as evidenced by Toddler-induced internalization of APJ/apelin receptors and rescue of Toddler mutants through expression of the known receptor agonist apelin. Pauli et al. (2014) concluded that their findings indicated that Toddler promotes cell movement during zebrafish gastrulation by activation of APJ/apelin receptor signaling and that Toddler does not seem to act as a chemoattractant or -repellent, but rather as a global, signal that promotes the movement of mesendodermal cells. Since both loss and overproduction of Toddler reduce cell movement, Toddler levels need to be tightly regulated during gastrulation.