Sequence 197 (siARHGEF12.1)
From Wikisequences
Sequence siARHGEF12.1 | |
---|---|
Target | ARHGEF12 (Homo sapiens) |
Description | Rho guanine nucleotide exchange factor (GEF) 12
Ensembl: ENSG00000196914 UniGene: Hs.24598 EntrezGene: 23365 Ensembl Chr11: 119713156 - 119865855 Strand: 1 GO terms: 0005085 0005089 0005096 0005515 0005622 0005737 0007242 0016020 0035023 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) CGTTTAGCCCTGTCATTAATT / siRNA antisense (21b) TTAATGACAGGGCTAAACGTG |
Application | gene silencing |
Name | siARHGEF12.1 |
References
Multiplexing siRNAs to compress RNAi-based screen size in human cells. Martin SE, Jones TL, Thomas CL, Lorenzi PL, Nguyen DA, Runfola T, Gunsior M, Weinstein JN, Goldsmith PK, Lader E, Huppi K, Caplen NJ. Nucleic Acids Res. 2007;35(8):e57.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478