Sequence 200 (arrestin-1 , arrestin1)

Sequence arrestin-1 , arrestin1
Target	ARRB1 ( Homo sapiens )
Description	Arrestin, beta 1 Ensembl: ENSG00000137486 UniGene: Hs.503284 EntrezGene: 408 Ensembl Chr11: 74654130 - 74740525 Strand: -1 GO terms: 0004857 0005515 0005624 0005625 0005737 0005834 0005886 0007165 0007600 0050896
Design	siRNA
Chemistry	RNA
Sequence	siRNA sense (21b) AGCCTTCTGCGCGGAGAATTT / siRNA antisense (21b) ATTCTCCGCGCAGAAGGCTTT
Application	gene silencing
Name	arrestin-1 , arrestin1

References

Reciprocal regulation of angiotensin receptor-activated extracellular signal-regulated kinases by beta-arrestins 1 and 2.Ahn S, Wei H, Garrison TR, Lefkowitz RJ.J Biol Chem. 2004 Feb 27;279(9) :7807-11. Epub 2004 Jan 7.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background

Gene Function. Lohse et al. (1990) found that purified beta-arrestin inhibited the signaling function of BARK-phosphorylated beta-adrenergic receptors by more than 75%, but not that of rhodopsin (180380).

Luttrell et al. (1999) showed that stimulation of beta-2 adrenergic receptors (see 109690) resulted in the assembly of a protein complex containing activated SRC (SRC; 190090) and the receptor. They demonstrated that SRC binds to beta-arrestin-1 at its amino terminus. Beta-arrestin-1 mutants, impaired either in SRC binding or in the ability to target receptors to clathrin-coated pits, acted as dominant negative inhibitors of beta-2 adrenergic receptor-mediated activation of the MAP kinases ERK1 (601795) and ERK2 (176948).

Buchanan et al. (2006) found that prostaglandin E2 (PGE2) induced association of PGE2 receptor-4 (PTGER4; 601586), beta-arrestin-1, and Src in a signaling complex that transactivated EGF receptor (EGFR; 131550) and downstream AKT (see AKT1; 164730) signaling. The interaction of beta-arrestin-1 with Src was critical for regulation of human colorectal carcinoma cell migration in vitro, as well as for metastatic spread of disease from spleen to liver in nude mice.

Seven-transmembrane receptor signaling is transduced by second messengers such as diacylglycerol (DAG) generated in response to the heterotrimeric guanine nucleotide-binding protein G(q) (600998) and is terminated by receptor desensitization and degradation of the second messengers. Nelson et al. (2007) showed that beta-arrestins coordinate both processes for the G(q)-coupled M1 muscarinic receptor (CHRM1; 118510). Beta-arrestins physically interact with diacylglycerol kinases (see 125855), enzymes that degrade DAG. Moreover, beta-arrestins are essential for conversion of DAG to phosphatidic acid after agonist stimulation, and this activity requires recruitment of the beta-arrestin-DGK complex to activated 7-transmembrane receptors. The dual function of beta-arrestins, limiting production of diacylglycerol (by receptor desensitization) while enhancing its rate of degradation, is analogous to their ability to recruit adenosine 3-prime,5-prime-monophosphate phosphodiesterases to G(s) (139320)-coupled beta-2-adrenergic receptors (ADRB2; 109690). Thus, Nelson et al. (2007) concluded that beta-arrestins can serve similar regulatory functions for disparate classes of 7-transmembrane receptors through structurally dissimilar enzymes that degrade chemically distinct second messengers.

Kovacs et al. (2008) demonstrated that beta-arrestins mediate the activity-dependent interaction of Smoothened (SMO; 601500) and the kinesin motor protein KIF3A (604683). This multimeric complex localized to primary cilia and was disrupted in cells transfected with beta-arrestin small interfering RNA. Beta-arrestin-1 or beta-arrestin-2 (ARRB2; 107941) depletion prevented the localization of SMO to primary cilia and the SMO-dependent activation of GLI (165220). Kovacs et al. (2008) concluded that their results suggested roles for beta-arrestin in mediating the intracellular transport of a 7-transmembrane receptor to its obligate subcellular location for signaling. Animal Model.By use of gene targeting and blastocyst-mediated transgenesis, Conner et al. (1997) prepared beta-arrestin-1 knockout mice to define the physiologic role of beta-arrestin-1 in the regulation of G protein-coupled receptors such as the beta-adrenergic receptor. Homozygous mutants were structurally normal and had normal life spans. They displayed normal resting cardiovascular parameters but were more sensitive to beta-receptor agonist-stimulated increases in cardiac ejection fraction, consistent with a role for beta-arrestin-1 in beta-adrenergic receptor desensitization. This represents a mechanism for 'fine tuning' the beta-adrenergic receptor response, which may be open to pharmacologic manipulation.