Sequence 203 (siASNS.1)
From Wikisequences
| Sequence siASNS.1 | |
|---|---|
| Target | ASNS (Homo sapiens) |
| Description | Asparagine synthetase
Ensembl: ENSG00000070669 UniGene: Hs.489207 EntrezGene: 440 Ensembl Chr7: 97319379 - 97339732 Strand: -1 GO terms: 0004066 0005625 0006529 0006541 0008152 0008652 0016874 |
| Design | siRNA |
| Chemistry | RNA |
| Sequence | siRNA sense (21b) GGATACTGCCAATAAGAAATT / siRNA antisense (21b) TTTCTTATTGGCAGTATCCAG |
| Application | gene silencing |
| Name | siASNS.1 |
References
Multiplexing siRNAs to compress RNAi-based screen size in human cells. Martin SE, Jones TL, Thomas CL, Lorenzi PL, Nguyen DA, Runfola T, Gunsior M, Weinstein JN, Goldsmith PK, Lader E, Huppi K, Caplen NJ. Nucleic Acids Res. 2007;35(8):e57.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
