Sequence 216 (siSARS-2 , siSARS2)
Sequence siSARS-2 , siSARS2 | |
---|---|
Target | AY310120.1 ( SARS coronavirus FRA ) |
Description | |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (23b) TTTCGTGGTATTCTTGCTAGTTT / siRNA antisense (23b) ACTAGCAAGAATACCACGAAATT |
Application | gene silencing |
Name | siSARS-2 , siSARS2 |
References
Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs.Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX.Cell Res. 2005 Mar;15(3) :193-200.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
The SARS coronavirus is the virus that causes severe acute respiratory syndrome (SARS). SARS coronavirus is a positive and single stranded RNA virus belonging to a family of enveloped coronaviruses. Its genome is about 29.7kb, which is one of the largest among RNA viruses. The SARS virus has 13 known genes and 14 known proteins. There are 265 nucleotides in the 5'UTR and 342 nucleotides in the 3'UTR. SARS is similar to other coronaviruses in that its genome expression starts with translation of two large ORFs 1a and 1b, which are two polyproteins.
The functions of several of these proteins are known:ORFs 1a and 1b encode the replicase and there are four major structural proteins: nucleocapsid, spike, membrane and envelope. It also encodes for eight unique proteins, known as the accessory proteins, with no known homologues. The function of these accessory proteins remains unknown (McBride and Fielding 2012).
Coronaviruses usually express pp1a (the ORF1a polyprotein) and the PP1ab polyprotein with joins ORF1a and ORF1b. The polyproteins are then processed by enzymes that are encoded by ORF1a. Product proteins from the processing includes various replicative enzymes such as RNA dependent polymerase, RNA helicase, and proteinase. The replication complex in coronavirus is also responsible for the synthesis of various mRNAs downstream of ORF 1b, which are structural and accessory proteins. Two different proteins, 3CLpro and PL2pro, cleave the large polyproteins into 16 smaller subunits.