Sequence 24 (sll1796)
From Wikisequences
Sequence sll1796 | |
---|---|
Target | 6803s07 ( Synechocystis sp. PCC 6803 ) |
Description | |
Design | primer set |
Chemistry | DNA |
Sequence | Forward PCR primer (20b) TCAACCCCAGCAAAACCTTAA / Reverse PCR primer (20b) CGCCACGGAATTTTTACCAT |
Application | gene expression |
Name | sll1796 |
References
Integrated OMICS guided engineering of biofuel butanol-tolerance in photosynthetic Synechocystis sp. PCC 6803.Zhu H, Ren X, Wang J, Song Z, Shi M, Qiao J, Tian X, Liu J, Chen L, Zhang W.Biotechnol Biofuels. 2013 Jul 25;6(1) :106. doi: 10.1186/1754-6834-6-106.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478