Sequence 250 (siJEV-M , siJEVM)
From Wikisequences
| Sequence siJEV-M , siJEVM | |
|---|---|
| Target | AF036917.1 ( Japanese encephalitis virus ) |
| Description | |
| Design | siRNA |
| Chemistry | RNA |
| Sequence | siRNA sense (21b) CAACACGGACATTGCAGACTT / siRNA antisense (20b) TCTGCAATGTCCGTGTTGTT |
| Application | gene silencing |
| Name | siJEV-M , siJEVM |
References
Inhibition of SARS-CoV replication by siRNA.Wu CJ, Huang HW, Liu CY, Hong CF, Chan YL.Antiviral Res. 2005 Jan;65(1) :45-8.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
