Sequence 267 (BAG246-chem , BAG246chem)
Sequence BAG246-chem , BAG246chem | |
---|---|
Target | BAG1 ( Homo sapiens ) |
Description | BCL2-associated athanogene
Ensembl: ENSG00000081014 UniGene: Hs.377484 EntrezGene: 573 Ensembl Chr15: 48988238 - 49085389 Strand: 1 GO terms: 0005198 0005515 0005794 0005905 0006461 0006886 0008565 0016020 0016192 0030117 0030126 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) AGAACAGTCCACAGGAAGATT / siRNA antisense (21b) TCTTCCTGTGGACTGTTCTTT |
Application | gene silencing |
Name | BAG246-chem , BAG246chem |
References
Down-regulation of Bcl-2-interacting protein BAG-1 confers resistance to anti-cancer drugs.Takahashi N, Yanagihara M, Ogawa Y, Yamanoha B, Andoh T.Biochem Biophys Res Commun. 2003 Feb 14;301(3) :798-803.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
Description. The heterotetrameric adaptor protein (AP) complexes sort integral membrane proteins at various stages of the endocytic and secretory pathways. AP4 is composed of 2 large chains, beta-4 (AP4B1; 607245) and epsilon-4 (AP4E1), a medium chain, mu-4 (AP4M1; 602296), and a small chain, sigma-4 (AP4S1; 607243).