Sequence 271 (siBAG3.2)
From Wikisequences
Sequence siBAG3.2 | |
---|---|
Target | BAG3 (Homo sapiens) |
Description | BCL2-associated athanogene 3
Ensembl: ENSG00000106588 UniGene: Hs.702046 EntrezGene: 9531 Ensembl Chr7: 42922989 - 42938330 Strand: -1 GO terms: 0004175 0004298 0005515 0005634 0005737 0005829 0005839 0006511 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) CGATGTGTGCTTTAGGGAATT / siRNA antisense (21b) TTCCCTAAAGCACACATCGGT |
Application | gene silencing |
Name | siBAG3.2 |
References
Multiplexing siRNAs to compress RNAi-based screen size in human cells. Martin SE, Jones TL, Thomas CL, Lorenzi PL, Nguyen DA, Runfola T, Gunsior M, Weinstein JN, Goldsmith PK, Lader E, Huppi K, Caplen NJ. Nucleic Acids Res. 2007;35(8):e57.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478