Sequence 272 (siBAG4.1)
From Wikisequences
Sequence siBAG4.1 | |
---|---|
Target | BAG4 (Homo sapiens) |
Description | BCL2-associated athanogene 4
Ensembl: ENSG00000129084 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) GGATATAATCTGAGACAAATT / siRNA antisense (21b) TTTGTCTCAGATTATATCCAG |
Application | gene silencing |
Name | siBAG4.1 |
References
Multiplexing siRNAs to compress RNAi-based screen size in human cells. Martin SE, Jones TL, Thomas CL, Lorenzi PL, Nguyen DA, Runfola T, Gunsior M, Weinstein JN, Goldsmith PK, Lader E, Huppi K, Caplen NJ. Nucleic Acids Res. 2007;35(8):e57.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478