Sequence 276 (BARX2si2)

Sequence BARX2si2
Target	BARX2 ( Homo sapiens )
Description	BARX homeobox 2 Ensembl: ENSG00000043039 UniGene: Hs.591944 EntrezGene: 8538 Ensembl Chr11: 128751045 - 128827014 Strand: 1 GO terms: 0000122 0003682 0003700 0003702 0005515 0005634 0005667 0006355 0006366 0030154 0042637 0043565 0045445
Design	shRNA
Chemistry	RNA
Sequence	(68b) GATCCCCGAGTCAGAGACGGAACAGCCCTTCAAGAGAGGGCTGTTCCGTCTCTGACTCTTTTTGGAAC /
Application	gene silencing
Name	BARX2si2

References

Identification of novel binding elements and gene targets for the homeodomain protein BARX2.Stevens TA, Iacovoni JS, Edelman DB, Meech R.J Biol Chem. 2004 Apr 9;279(15) :14520-30. Epub 2004 Jan 26.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background