Sequence 277 (BARX2si3)

From Wikisequences
Jump to: navigation, search
Sequence BARX2si3
Target BARX2 ( Homo sapiens )
Description BARX homeobox 2

Ensembl: ENSG00000043039 UniGene: Hs.591944 EntrezGene: 8538 Ensembl Chr11: 128751045 - 128827014 Strand: 1 GO terms: 0000122 0003682 0003700 0003702 0005515 0005634 0005667 0006355 0006366 0030154 0042637 0043565 0045445

Design shRNA
Chemistry RNA
Sequence (64b) GATCCCAAGGAGACCTGCGATTACTTTTCAAGAGAAAGTAATCGCAGGTCTCCTTGTTTTTAAC /
Application gene silencing
Name BARX2si3

References

Identification of novel binding elements and gene targets for the homeodomain protein BARX2.Stevens TA, Iacovoni JS, Edelman DB, Meech R.J Biol Chem. 2004 Apr 9;279(15) :14520-30. Epub 2004 Jan 26.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Comments

Background

Support Doctors Without Borders