Sequence 280 (mBcl-x , mBclx)
| Sequence mBcl-x , mBclx | |
|---|---|
| Target | Bcl2 ( Mus musculus ) |
| Description | B-cell leukemia/lymphoma 2
Ensembl: ENSMUSG00000057329 UniGene: Mm.257460 EntrezGene: 12043 Ensembl Chr1: 108434755 - 108610851 Strand: -1 GO terms: 0000074 0001666 0001836 0002020 0005515 0005634 0005737 0005739 0005741 0005783 0005829 0006916 0007584 0008284 0009408 0009636 0010035 0010039 0016020 0016021 0031000 0031069 0031965 |
| Design | siRNA |
| Chemistry | RNA |
| Sequence | siRNA sense (21b) GGATACAGCTGGAGTCAGTTT / siRNA antisense (21b) ACTGACTCCAGCTGTATCCTT |
| Application | gene silencing |
| Name | mBcl-x , mBclx |
References
Role of Bcl-2 family proteins in a non-apoptotic programmed cell death dependent on autophagy genes.Shimizu S, Kanaseki T, Mizushima N, Mizuta T, Arakawa-Kobayashi S, Thompson CB, Tsujimoto Y.Nat Cell Biol. 2004 Dec;6(12) :1221-8. Epub 2004 Nov 21.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
