Sequence 285 (Bcl-2 , Bcl2)

Sequence Bcl-2 , Bcl2
Target	BCL2 ( Homo sapiens )
Description	B-cell CLL/lymphoma 2 Ensembl: ENSG00000171791 UniGene: Hs.150749 EntrezGene: 596 Ensembl Chr18: 58941559 - 59138341 Strand: -1 GO terms: 0000074 0001666 0001836 0002020 0005515 0005634 0005737 0005739 0005741 0005783 0005829 0006916 0006959 0007565 0007584 0008284 0009314 0009408 0009636 0010035 0010039 0016020 0016021
Design	shRNA
Chemistry	RNA
Sequence	(49b) GTGATGAAGTACATCCATTTTCAAGAGAAATGGATGTACTTCATCACTT
Application	gene silencing
Name	Bcl-2 , Bcl2

References

Evidence for a protective role of Mcl-1 in proteasome inhibitor-induced apoptosis.Nencioni A, Hua F, Dillon CP, Yokoo R, Scheiermann C, Cardone MH, Barbieri E, Rocco I, Garuti A, Wesselborg S, Belka C, Brossart P, Patrone F, Ballestrero A.Blood. 2005 Apr 15;105(8) :3255-62. Epub 2004 Dec 21.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background

Gene Function. Ngan et al. (1988) found immunoreactive BCL2 protein in the neoplastic cells of almost all follicular lymphomas, whereas no BCL2 protein was detected in follicles affected by nonneoplastic processes or in normal lymphoid tissue.

By means of immunolocalization studies, Hockenbery et al. (1990) demonstrated that BCL2 is an integral inner mitochondrial membrane protein of relative molecular mass 25,000. Overexpression of BCL2 blocks the apoptotic death of a pro-B-lymphocyte cell line. Thus, BCL2 is unique among protooncogenes, being localized in mitochondria and interfering with programmed cell death independent of promoting cell division.

Wang et al. (1996) showed that BCL2 can target the protein kinase RAF1 (164760) to the mitochondria. Active RAF1 improved BCL2-mediated resistance to apoptosis.

Vaux et al. (1988) undertook to determine the biologic effects of the BCL2 gene by introducing BCL2 cDNA into bone marrow cells. They found that BCL2 cooperated with MYC to promote proliferation of B-cell precursors, some of which became tumorigenic. Reed et al. (1988) also demonstrated the oncogenic potential of BCL2 by gene transfer.

Tsujimoto (1989) used Epstein-Barr virus-infected human lymphoblastoid B-cell lines transfected with BCL2 sequences and driven by the simian virus 40 promoter and enhancer to demonstrate that overproduction of the BCL2 protein results in a distinct cellular growth advantage. Nunez et al. (1989) demonstrated the protooncogene role of BCL2 in B-cell growth and B-cell neoplasm formation. ERV1 is separate from BCL2 (Croce, 1989).

Animal Model. Nakayama et al. (1994) reported results from the study of BCL2-deficient mice created through the injection of clones containing 1 mutated bcl2 allele into C57BL/6 blastocysts to generate chimeric mice. Animals homozygous for the mutation were smaller but viable, although about half of them died by 6 weeks of age. As shown earlier with somatic bcl2 gene-targeted mice, the number of lymphocytes markedly decreased within a few weeks after birth while other hematopoietic lineages remained unaffected. Among lymphocytes, CD8(+) T cells disappeared most quickly followed by CD4(+) T cells, whereas B cells were least affected. The homozygously defective lymphocytes could, however, respond normally to various stimuli including anti-CD3, Con A, interleukin-2, lipopolysaccharide, and anti-IgM antibody. Abnormalities in nonlymphoid organs included smaller auricles, hair color turning gray at 4 to 5 weeks of age, and polycystic kidney disease-like change of renal tubules. These results suggested that bcl2 may be involved during morphogenesis where inductive interactions between epithelium and mesenchyme are important such as in the kidneys, hair follicles, and perichondrium of auricles. Surprisingly, the nervous system, intestines, and skin appeared normal despite the fact that these organs show high levels of endogenous bcl2 expression in normal mice.

McDonnell et al. (1989) found that transgenic mice bearing a bcl2-immunoglobulin minigene that mimicked the t(14;18) translocation displayed a polyclonal follicular hyperplasia with a 4-fold increase in resting B cells. B cells accumulated because of extended cell survival rather than increased proliferation.

By crossing mice with motoneuron disease (pmn) with mice that overexpressed Bcl2, Sagot et al. (1995) demonstrated rescue of facial motoneurons with restoration of normal soma size and expression of choline acetyltransferase. However, Bcl2 overexpression did not prevent degeneration of myelinated axons and did not increase the life span of the animals.

Apoptosis of photoreceptors occurs infrequently in adult retina and can be triggered in inherited and environmentally induced retinal degenerations. BCL2 is known to be a potent regulator of cell survival in neurons. Chen et al. (1996) created lines of transgenic mice overexpressing Bcl2 to test for its ability to increase photoreceptor survival. They found that Bcl2 increased photoreceptor survival in 3 mouse models: a line of transgenic mice expressing a C-terminal truncated form of rhodopsin (180380) associated with rapid degeneration of photoreceptors; homozygous rd mice with nonfunctional rod-cGMP-phosphodiesterase (see 180071); and albino mice exposed to sustained illumination. Bcl2 increased photoreceptor survival in the first 2 mouse models and decreased the damaging effects of constant light exposure in the albino mice. Apoptosis was induced in normal photoreceptors by very high levels of Bcl2. Chen et al. (1996) concluded that Bcl2 is an important regulator of photoreceptor cell death in retinal degenerations.

Martinou et al. (1994) generated transgenic mice in which neurons overexpress the human BCL2 protein under control of neuron-specific enolase or phosphoglycerate kinase promoters. These transgenic mice had reduced neuronal loss during the period of naturally occurring cell death with a resulted hypertrophy of the nervous system. The facial nucleus and the ganglion cell layer of the retina had 40 to 50% more neurons than in control animals. In addition, these transgenic mice were more resistant to ischemic damage induced by middle cerebral artery occlusion than were control mice.