Sequence 295 (si 085)

From Wikisequences
Jump to: navigation, search
Sequence si_085
Target BCL2L1 ( Homo sapiens )
Description BCL2-like 1

Ensembl: ENSG00000084234 UniGene: Hs.516966 EntrezGene: 598 Ensembl Chr11: 129445011 - 129519910 Strand: 1 GO terms: 0001967 0003677 0004867 0005488 0005515 0005634 0006878 0007186 0007617 0007626 0009790 0016020 0016021 0030198 0030900 0030901 0042309 0050825 0050826 0050885

Design siRNA
Chemistry RNA
Sequence siRNA sense (21b) CAGAAAGGATACAGCTGGAGT / siRNA antisense (21b) TCCAGCTGTATCCTTTCTGGG
Application gene silencing
Name si_085

References

DSIR: assessing the design of highly potent siRNA by testing a set of cancer-relevant target genes. Filhol O, Ciais D, Lajaunie C, Charbonnier P, Foveau N, Vert JP, Vandenbrouck Y. PLoS One. 2012;7(10):e48057.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Comments

Background

Description. The vacuolar-type H(+)-ATPase (V-ATPase) is responsible for the acidification of endosomes, lysosomes, and other intracellular organelles. It is also involved in hydrogen ion transport across the plasma membrane into the extracellular space. The V-ATPase is a multisubunit complex with cytosolic and transmembrane domains. The cytosolic catalytic domain consists of 3 A subunits and 3 B subunits, which bind and hydrolyze ATP, as well as regulatory accessory subunits including C (603097), D (607028), and E.

Support Doctors Without Borders