Sequence 302 (bestrophin)
From Wikisequences
Sequence bestrophin | |
---|---|
Target | BEST1 ( Homo sapiens ) |
Description | Bestrophin 1
Ensembl: ENSG00000167995 UniGene: Hs.705554 EntrezGene: 7439 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) CACAAGCAGTTGGAGAAACTT / siRNA antisense (21b) GTTTCTCCAACTGCTTGTGTT |
Application | gene silencing |
Name | bestrophin |
References
The role of bestrophin in airway epithelial ion transport.Duta V, Szkotak AJ, Nahirney D, Duszyk M.FEBS Lett. 2004 Nov 19;577(3) :551-4.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478