Sequence 310 (sh mWASP)
Sequence sh_mWASP | |
---|---|
Target | BUB1 ( Homo sapiens ) |
Description | BUB1 budding uninhibited by benzimidazoles 1 homolog ( yeast )
Ensembl: ENSG00000169679 UniGene: Hs.469649 EntrezGene: 699 Ensembl Chr2: 111111883 - 111152135 Strand: -1 GO terms: 0000166 0000776 0004672 0004674 0005524 0005634 0005816 0006468 0007049 0007067 0007094 0008283 0016740 0051301 |
Design | shRNA |
Chemistry | RNA |
Sequence | (70b) AGATCTCCGACGAGATGCTCCAAATGGTTCAAGAGACCATTTGGAGCATCTCGTCTTTTTGGAAAAGCTT |
Application | gene silencing |
Name | sh_mWASP |
References
N-WASP and WAVE2 acting downstream of phosphatidylinositol 3-kinase are required for myogenic cell migration induced by hepatocyte growth factor.Kawamura K, Takano K, Suetsugu S, Kurisu S, Yamazaki D, Miki H, Takenawa T, Endo T.J Biol Chem. 2004 Dec 24;279(52) :54862-71. Epub 2004 Oct 20.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478