Sequence 316 (Cand1)
From Wikisequences
Sequence Cand1 | |
---|---|
Target | CAND1 ( Homo sapiens ) |
Description | Cullin-associated and neddylation-dissociated 1
Ensembl: ENSG00000111530 UniGene: Hs.546407 EntrezGene: 55832 Ensembl Chr12: 65949426 - 65994658 Strand: 1 GO terms: 0000151 0005515 0005634 0006350 0006355 0016563 0016567 0030154 0043086 0045899 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) TGATTTGATGACGGAACTGTT / siRNA antisense (21b) CAGTTCCGTCATCAAATCATT |
Application | gene silencing |
Name | Cand1 |
References
Targeted ubiquitination of CDT1 by the DDB1-CUL4A-ROC1 ligase in response to DNA damage.Hu J, McCall CM, Ohta T, Xiong Y.Nat Cell Biol. 2004 Oct;6(10) :1003-9. Epub 2004 Sep 26.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478