Sequence 31 (siABCC1.2)
From Wikisequences
| Sequence siABCC1.2 | |
|---|---|
| Target | ABCC1 (Homo sapiens) |
| Description | ATP-binding cassette, sub-family C (CFTR/MRP), member 1
Ensembl: ENSG00000103222 UniGene: Hs.705367 EntrezGene: 4363 |
| Design | siRNA |
| Chemistry | RNA |
| Sequence | siRNA sense (21b) GAGTGGAATTCCGGAACTATT / siRNA antisense (21b) TAGTTCCGGAATTCCACTCGG |
| Application | gene silencing |
| Name | siABCC1.2 |
References
Multiplexing siRNAs to compress RNAi-based screen size in human cells. Martin SE, Jones TL, Thomas CL, Lorenzi PL, Nguyen DA, Runfola T, Gunsior M, Weinstein JN, Goldsmith PK, Lader E, Huppi K, Caplen NJ. Nucleic Acids Res. 2007;35(8):e57.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
