Sequence 320 (CAV1-1 , CAV11)
| Sequence CAV1-1 , CAV11 | |
|---|---|
| Target | CAV1 ( Homo sapiens ) |
| Description | Caveolin 1, caveolae protein, 22kDa
Ensembl: ENSG00000131100 UniGene: Hs.74034 EntrezGene: 857 Ensembl Chr22: 16454902 - 16491588 Strand: -1 GO terms: 0005515 0005737 0005739 0005886 0006811 0008553 0015986 0015991 0015992 0016469 0016787 0046872 0046933 0046961 |
| Design | siRNA |
| Chemistry | RNA |
| Sequence | siRNA sense (21b) CCTGATTGAGATTCAGTGCTT / siRNA antisense (21b) GCACTGAATCTCAATCAGGTT |
| Application | gene silencing |
| Name | CAV1-1 , CAV11 |
References
A distinct class of endosome mediates clathrin-independent endocytosis to the Golgi complex.Nichols BJ.Nat Cell Biol. 2002 May;4(5) :374-8.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
Description. The vacuolar-type H(+)-ATPase (V-ATPase) is responsible for the acidification of endosomes, lysosomes, and other intracellular organelles. It is also involved in hydrogen ion transport across the plasma membrane into the extracellular space. The V-ATPase is a multisubunit complex with cytosolic and transmembrane domains. The cytosolic catalytic domain consists of 3 A subunits and 3 B subunits, which bind and hydrolyze ATP, as well as regulatory accessory subunits including C (603097), D (607028), and E.
