Sequence 322 (siCAV1.1)

Sequence siCAV1.1
Target	CAV1 (Homo sapiens)
Description	Caveolin 1, caveolae protein, 22kDa Ensembl: ENSG00000131100 UniGene: Hs.74034 EntrezGene: 857 Ensembl Chr22: 16454902 - 16491588 Strand: -1 GO terms: 0005515 0005737 0005739 0005886 0006811 0008553 0015986 0015991 0015992 0016469 0016787 0046872 0046933 0046961
Design	siRNA
Chemistry	RNA
Sequence	siRNA sense (21b) GCAACAATTTATGAATTGATT / siRNA antisense (21b) TCAATTCATAAATTGTTGCTG
Application	gene silencing
Name	siCAV1.1

References

Multiplexing siRNAs to compress RNAi-based screen size in human cells. Martin SE, Jones TL, Thomas CL, Lorenzi PL, Nguyen DA, Runfola T, Gunsior M, Weinstein JN, Goldsmith PK, Lader E, Huppi K, Caplen NJ. Nucleic Acids Res. 2007;35(8):e57.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background

Description. The vacuolar-type H(+)-ATPase (V-ATPase) is responsible for the acidification of endosomes, lysosomes, and other intracellular organelles. It is also involved in hydrogen ion transport across the plasma membrane into the extracellular space. The V-ATPase is a multisubunit complex with cytosolic and transmembrane domains. The cytosolic catalytic domain consists of 3 A subunits and 3 B subunits, which bind and hydrolyze ATP, as well as regulatory accessory subunits including C (603097), D (607028), and E.