Sequence 327 (CT-1 , CT1)
From Wikisequences
| Sequence CT-1 , CT1 | |
|---|---|
| Target | CCNT1 ( Homo sapiens ) |
| Description | Cyclin T1
Ensembl: ENSG00000129315 UniGene: Hs.279906 EntrezGene: 904 Ensembl Chr12: 47373019 - 47397048 Strand: -1 GO terms: 0000074 0000079 0003677 0005515 0005634 0005730 0006355 0006366 0006468 0007049 0017069 0019901 0045449 0051301 |
| Design | shRNA |
| Chemistry | RNA |
| Sequence | (49b) GAACTTTCTTATCGCCAGCTTCAAGAGAGCTGGCGATAAGAAAGTTCTT |
| Application | gene silencing |
| Name | CT-1 , CT1 |
References
Specific inhibition of HIV-1 replication by short hairpin RNAs targeting human cyclin T1 without inducing apoptosis.Li Z, Xiong Y, Peng Y, Pan J, Chen Y, Wu X, Hussain S, Tien P, Guo D.FEBS Lett. 2005 Jun 6;579(14) :3100-6.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
