Sequence 334 (CCR7)
From Wikisequences
| Sequence CCR7 | |
|---|---|
| Target | CCR7 ( Homo sapiens ) |
| Description | Chemokine ( C-C motif ) receptor 7
Ensembl: ENSG00000126353 UniGene: Hs.370036 EntrezGene: 1236 Ensembl Chr17: 35963550 - 35975250 Strand: -1 GO terms: 0001584 0004872 0004918 0004945 0004947 0004983 0005886 0005887 0006935 0006954 0007165 0007186 0007204 0016021 0016493 0016494 0045028 |
| Design | siRNA |
| Chemistry | RNA |
| Sequence | siRNA sense (21b) GAGGCTCAAGACCATGACCTT / siRNA antisense (21b) GGTCATGGTCTTGAGCCTCTT |
| Application | gene silencing |
| Name | CCR7 |
References
Identification of cell surface targets for HIV-1 therapeutics using genetic screens.Dunn SJ, Khan IH, Chan UA, Scearce RL, Melara CL, Paul AM, Sharma V, Bih FY, Holzmayer TA, Luciw PA, Abo A.Virology. 2004 Apr 10;321(2) :260-73.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
