Sequence 335 (CCRi-436 , CCRi436)
From Wikisequences
| Sequence CCRi-436 , CCRi436 | |
|---|---|
| Target | CCR9 ( Homo sapiens ) |
| Description | Chemokine ( C-C motif ) receptor 9
Ensembl: ENSG00000173585 UniGene: Hs.225946 EntrezGene: 10803 Ensembl Chr3: 45903023 - 45919671 Strand: 1 GO terms: 0001584 0004872 0004918 0004942 0004945 0004947 0005515 0005886 0005887 0006935 0006955 0006968 0007165 0007186 0007204 0016021 0016493 0016494 |
| Design | siRNA |
| Chemistry | RNA |
| Sequence | siRNA sense (21b) GGTGGTCAACAGCATGTACTT / siRNA antisense (21b) GTTCATGCTGTTGACCACCTT |
| Application | gene silencing |
| Name | CCRi-436 , CCRi436 |
References
Iterative microarray and RNA interference-based interrogation of the SRC-induced invasive phenotype.Irby RB, Malek RL, Bloom G, Tsai J, Letwin N, Frank BC, Verratti K, Yeatman TJ, Lee NH.Cancer Res. 2005 Mar 1;65(5) :1814-21.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
