Sequence 343 (CD74)
From Wikisequences
Sequence CD74 | |
---|---|
Target | CD74 ( Homo sapiens ) |
Description | CD74 molecule, major histocompatibility complex, class II invariant chain
Ensembl: ENSG00000019582 UniGene: Hs.436568 EntrezGene: 972 Ensembl Chr5: 149761426 - 149772685 Strand: -1 GO terms: 0000187 0001516 0005622 0006457 0006461 0006886 0006955 0007165 0008283 0016020 0016021 0016064 0019882 0019883 0019955 0042289 0042802 0043030 0043066 0045058 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) ACTGACAGTCACCTCCCAGTT / siRNA antisense (21b) CTGGGAGGTGACTGTCAGTTT |
Application | gene silencing |
Name | CD74 |
References
Identification of cell surface targets for HIV-1 therapeutics using genetic screens.Dunn SJ, Khan IH, Chan UA, Scearce RL, Melara CL, Paul AM, Sharma V, Bih FY, Holzmayer TA, Luciw PA, Abo A.Virology. 2004 Apr 10;321(2) :260-73.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478