Sequence 344 (siKAI1.1)
From Wikisequences
Sequence siKAI1.1 | |
---|---|
Target | CD82 (Homo sapiens) |
Description | CD82 molecule
Ensembl: ENSG00000085117 UniGene: Hs.527778 EntrezGene: 3732 Ensembl Chr11: 44543717 - 44597889 Strand: 1 GO terms: 0005515 0005886 0005887 0016020 0016021 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) GGGTTCTCTTATCAACTCATT / siRNA antisense (21b) TGAGTTGATAAGAGAACCCTG |
Application | gene silencing |
Name | siKAI1.1 |
References
Multiplexing siRNAs to compress RNAi-based screen size in human cells. Martin SE, Jones TL, Thomas CL, Lorenzi PL, Nguyen DA, Runfola T, Gunsior M, Weinstein JN, Goldsmith PK, Lader E, Huppi K, Caplen NJ. Nucleic Acids Res. 2007;35(8):e57.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478