Sequence 348 (siCDH1.1)
From Wikisequences
Sequence siCDH1.1 | |
---|---|
Target | CDH1 (Homo sapiens) |
Description | Cadherin 1, type 1, E-cadherin (epithelial)
Ensembl: ENSG00000039068 UniGene: Hs.461086 EntrezGene: 999 Ensembl Chr16: 67328696 - 67426943 Strand: 1 GO terms: 0003674 0005509 0005515 0005886 0005913 0007155 0007156 0008013 0016020 0016021 0016323 0019538 0030054 0043281 0045177 0051260 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) GGCCTGAAGTGACTCGTAATT / siRNA antisense (21b) TTACGAGTCACTTCAGGCCGA |
Application | gene silencing |
Name | siCDH1.1 |
References
Multiplexing siRNAs to compress RNAi-based screen size in human cells. Martin SE, Jones TL, Thomas CL, Lorenzi PL, Nguyen DA, Runfola T, Gunsior M, Weinstein JN, Goldsmith PK, Lader E, Huppi K, Caplen NJ. Nucleic Acids Res. 2007;35(8):e57.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478