Sequence 349 (Cdc1)
Sequence Cdc1 | |
---|---|
Target | CDK1 ( Homo sapiens ) |
Description | Transcribed locus
Ensembl: ENSG00000170312 UniGene: Hs.623223 EntrezGene: 983 Ensembl Chr10: 62208107 - 62224616 Strand: 1 GO terms: 0000074 0000166 0004672 0004674 0004693 0004713 0005515 0005524 0005634 0005876 0006468 0006916 0007049 0007067 0007089 0007095 0016740 0030496 0030544 0051301 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) GGGGTTCCTAGTACTGCAATT / siRNA antisense (21b) TTGCAGTACTAGGAACCCCTT |
Application | gene silencing |
Name | Cdc1 |
References
Cyclin A/Cdk2 complexes regulate activation of Cdk1 and Cdc25 phosphatases in human cells.Mitra J, Enders GH.Oncogene. 2004 Apr 22;23(19) :3361-7.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
Description. Cyclin-dependent kinase-1 (CDK1; EC 2.7.11.22), also known as CDC2, is a catalytic subunit of a protein kinase complex, called the M-phase promoting factor, that induces entry into mitosis and is universal among eukaryotes. In the fission yeast Schizosaccharomyces pombe, the gene cdc2 is responsible for controlling the transition from G1 phase to the S phase and from the G2 phase to the M phase of the cell cycle.