Sequence 359 (Ex2)
From Wikisequences
Sequence Ex2 | |
---|---|
Target | CDKN2A ( Homo sapiens ) |
Description | Cyclin-dependent kinase inhibitor 2A ( melanoma, p16, inhibits CDK4 )
Ensembl: ENSG00000100739 |
Design | shRNA |
Chemistry | RNA |
Sequence | (49b) GGCAGTAACCATGCCCGCATTCAAGAGATGCGGGCATGGTTACTGCCTT |
Application | gene silencing |
Name | Ex2 |
References
The tumor-suppressive functions of the human INK4A locus.Voorhoeve PM, Agami R.Cancer Cell. 2003 Oct;4(4) :311-9.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478