Sequence 35 (ISIS-445236 , ISIS 445236)

From Wikisequences
Jump to: navigation, search
Sequence ISIS-445236 , ISIS 445236
Target ACTA1 ( Homo sapiens )
Description Actin, alpha 1 , skeletal muscle

Ensembl: ENSG00000143632 UniGene: Hs.1288 EntrezGene: 58 Ensembl Chr1: 227633615 - 227636468 Strand: -1 GO terms: 0000166 0001725 0004618 0005198 0005200 0005515 0005524 0005737 0005856 0005865 0005884 0006096 0006936 0017022 0030240 0043531 0048741

Design MOE gapmer
Chemistry moC*moC*moA*moT*moT*T*T*C*T*T*C*C*A*C*A*moG*moG*moG*moC*moT
Sequence CCATTTTCTTCCACAGGGCT
Application gene silencing
Name ISIS-445236 , ISIS 445236

References

Targeting nuclear RNA for in vivo correction of myotonic dystrophy. Wheeler TM1, Leger AJ, Pandey SK, MacLeod AR, Nakamori M, Cheng SH, Wentworth BM, Bennett CF, Thornton CA. Nature. 2012 Aug 2;488(7409):111-5.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Comments

Background

Support Doctors Without Borders