Sequence 360 (CENP-E 1 , CENPE1)
From Wikisequences
| Sequence CENP-E_1 , CENPE1 | |
|---|---|
| Target | CENPE ( Homo sapiens ) |
| Description | Centromere protein E, 312kDa
Ensembl: ENSG00000106605 |
| Design | siRNA |
| Chemistry | RNA |
| Sequence | siRNA sense (21b) GCTTGTGATGCCATCCTGATT / siRNA antisense (21b) TCAGGATGGCATCACAAGCTT |
| Application | gene silencing |
| Name | CENP-E_1 , CENPE1 |
References
Gene silencing of CENP-E by small interfering RNA in HeLa cells leads to missegregation of chromosomes after a mitotic delay.Tanudji M, Shoemaker J, L'Italien L, Russell L, Chin G, Schebye XM.Mol Biol Cell. 2004 Aug;15(8) :3771-81. Epub 2004 Jun 4.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
