Sequence 36 (ISIS-445238 , ISIS 445238)
From Wikisequences
Sequence ISIS-445238 , ISIS 445238 | |
---|---|
Target | ACTA1 ( Homo sapiens ) |
Description | Actin, alpha 1 , skeletal muscle
Ensembl: ENSG00000143632 UniGene: Hs.1288 EntrezGene: 58 Ensembl Chr1: 227633615 - 227636468 Strand: -1 GO terms: 0000166 0001725 0004618 0005198 0005200 0005515 0005524 0005737 0005856 0005865 0005884 0006096 0006936 0017022 0030240 0043531 0048741 |
Design | MOE gapmer |
Chemistry | moC*moA*moG*moA*moA*T*G*A*C*T*T*T*A*A*T*moG*moC*moT*moT*moC |
Sequence | CAGAATGACTTTAATGCTTC |
Application | gene silencing |
Name | ISIS-445238 , ISIS 445238 |
References
Targeting nuclear RNA for in vivo correction of myotonic dystrophy. Wheeler TM1, Leger AJ, Pandey SK, MacLeod AR, Nakamori M, Cheng SH, Wentworth BM, Bennett CF, Thornton CA. Nature. 2012 Aug 2;488(7409):111-5.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478