Sequence 386 (FP1775)
From Wikisequences
Sequence FP1775 | |
---|---|
Target | CSF2RB ( Homo sapiens ) |
Description | Colony stimulating factor 2 receptor, beta, low-affinity ( granulocyte-macrophage )
Ensembl: ENSG00000100368 UniGene: Hs.592192 EntrezGene: 1439 Ensembl Chr22: 35648168 - 35664764 Strand: 1 GO terms: 0004872 0004896 0004907 0004912 0004914 0007165 0007585 0016020 0016021 0019221 0030526 |
Design | shRNA |
Chemistry | RNA |
Sequence | (64b) GATCCCCCAGGCTTCCAGCTTTGACTTCAAGAGAAGTCAAAGCTGGAAGCCTGTTTTTTGGAAG |
Application | gene silencing |
Name | FP1775 |
References
Inhibition of GM-CSF receptor function by stable RNA interference in a NOD/SCID mouse hematopoietic stem cell transplantation model.Scherr M, Battmer K, Dallmann I, Ganser A, Eder M.Oligonucleotides. 2003;13(5) :353-63.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478