Sequence 392 (Csk1079)
Sequence Csk1079 | |
---|---|
Target | CSK ( Homo sapiens ) |
Description | Tyrosine-protein kinase
Ensembl: ENSG00000103653 UniGene: Hs.77793 EntrezGene: 2444 Ensembl Chr15: 72861768 - 72882557 Strand: 1 GO terms: 0000074 0000166 0004672 0004674 0004713 0005515 0005524 0005737 0005886 0005911 0006468 0007242 0008022 0008285 0016740 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) TGCATTAAGAACGACGCCACT / siRNA antisense (21b) TGGCGTCGTTCTTAATGCACT |
Application | gene silencing |
Name | Csk1079 |
References
Knockdown of C-terminal Src kinase by siRNA-mediated RNA interference augments T cell receptor signaling in mature T cells.Vang T, Abrahamsen H, Myklebust S, Enserink J, Prydz H, Mustelin T, Amarzguioui M, Tasken K.Eur J Immunol. 2004 Aug;34(8) :2191-9.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
Gene Function. CSK downregulates tyrosine kinase activity of the SRC oncoprotein (190090) through tyrosine phosphorylation of the SRC carboxy terminus. Since cell transformation by SRC oncoproteins is caused by various mechanisms that interfere with this phosphorylation, the CSK gene might function as an antioncogene (Armstrong et al., 1992).
Animal Model.Lowry et al. (2002) found that actin stress fiber formation induced by G proteins and G protein receptors was completely blocked in Csk-deficient mouse embryonic fibroblasts. Reintroduction of Csk into Csk-deficient cells restored G protein-induced actin stress fiber formation. Rescue experiments with catalytic mutants of Csk demonstrated that Csk catalytic activity was required for stress fiber formation. Lowry et al. (2002) found that G-beta (see GNB1; 139380)/G-gamma (see GNG2; 606981) dimers translocated Csk to the plasma membrane and directly increased Csk kinase activity. They concluded that CSK plays a critical role in mediating G protein signals in the reorganization of the actin cytoskeleton.
Cloutier and Veillette (1996) used the yeast 2-hybrid system to identify proteins associated with CSK. They found that the Src homology-3 (SH3) domain of CSK associates with a proline-rich region of PEP (600716), a protein-tyrosine phosphatase expressed in hemopoietic cells. Cloutier and Veillette (1996) showed that this association is highly specific and speculated that PEP may be an effector and/or regulator of CSK in T cells and other hemopoietic cells.