Sequence 40 (siADAM8.2)
From Wikisequences
| Sequence siADAM8.2 | |
|---|---|
| Target | ADAM8 (Homo sapiens) |
| Description | ADAM metallopeptidase domain 8
Ensembl: ENSG00000151651 UniGene: Hs.501574 EntrezGene: 101 Ensembl Chr10: 134925912 - 134940362 Strand: -1 GO terms: 0004222 0005886 0005887 0006508 0008237 0008270 0016337 0046872 |
| Design | siRNA |
| Chemistry | RNA |
| Sequence | siRNA sense (21b) GCATCATCGTCTACCGCAATT / siRNA antisense (21b) TTGCGGTAGACGATGATGCCT |
| Application | gene silencing |
| Name | siADAM8.2 |
References
Multiplexing siRNAs to compress RNAi-based screen size in human cells. Martin SE, Jones TL, Thomas CL, Lorenzi PL, Nguyen DA, Runfola T, Gunsior M, Weinstein JN, Goldsmith PK, Lader E, Huppi K, Caplen NJ. Nucleic Acids Res. 2007;35(8):e57.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
