Sequence 413 (si 044)
From Wikisequences
Sequence si_044 | |
---|---|
Target | CSNK2A2 ( Homo sapiens ) |
Description | Casein kinase 2, alpha prime polypeptide
Ensembl: ENSG00000134072 UniGene: Hs.82201 EntrezGene: 1459 Ensembl Chr3: 9774026 - 9786661 Strand: -1 GO terms: 0000166 0004672 0004674 0004713 0005516 0005524 0005634 0005737 0006468 0006913 0007165 0007275 0007399 0016740 0030154 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) GTGGTGGAACAAATATCATTA / siRNA antisense (21b) ATGATATTTGTTCCACCACGA |
Application | gene silencing |
Name | si_044 |
References
DSIR: assessing the design of highly potent siRNA by testing a set of cancer-relevant target genes. Filhol O, Ciais D, Lajaunie C, Charbonnier P, Foveau N, Vert JP, Vandenbrouck Y. PLoS One. 2012;7(10):e48057.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478