Sequence 41 ()
Sequence | |
---|---|
Target | ADAR ( Homo sapiens ) |
Description | Adenosine deaminase, RNA-specific
Ensembl: ENSG00000160710 UniGene: Hs.12341 EntrezGene: 103 Ensembl Chr1: 152821162 - 152867098 Strand: -1 GO terms: 0003677 0003723 0003725 0003726 0004000 0005622 0005634 0005737 0006396 0006397 0008270 0016553 0016787 0031047 0046872 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) CCAGCACAGCGGAGTGGTATT / siRNA antisense (21b) TACCACTCCGCTGTGCTGGTT |
Application | gene silencing |
Name |
References
Replicating hepatitis delta virus RNA is edited in the nucleus by the small form of ADAR1.Wong SK, Lazinski DW.Proc Natl Acad Sci U S A. 2002 Nov 12;99(23) :15118-23. Epub 2002 Oct 24.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
Description. Dyschromatosis symmetrica hereditaria (DSH), also called symmetric dyschromatosis of the extremities and symmetric or reticulate acropigmentation of Dohi (Komaya, 1924), is characterized by hyperpigmented and hypopigmented macules on the face and dorsal aspects of the extremities that appear in infancy or early childhood. DSH generally shows an autosomal dominant pattern of inheritance with high penetrance. The condition has been reported predominantly in Japanese and Chinese individuals.
Clinical Features. Patrizi et al. (1994) described a 9-year-old Caucasian girl with a mixture of hyperpigmented and hypopigmented macules on the backs of the feet. Two brothers had the same lesions, and all had small freckle-like pigmented macules on their face. The father showed large symmetrical hypopigmented vitiligo-like macules which had been present on the backs of his hands and the tops of his feet since childhood. Large symmetrical hypopigmented vitiligo-like macules were found also around his eyes and mouth, on his knees, and on his penis. These hypopigmented macules had progressively widened after the age of 28 years. The 9-year-old daughter had, since the age of 7 years, also shown a neurologic disorder diagnosed as idiopathic torsion dystonia. In all 4 patients, no cellular abnormality in DNA repair was demonstrated, thus excluding a mild form of xeroderma pigmentosum. Torsion dystonia (TYD1; 128100) maps to 9q34. Because of the family of Patrizi et al. (1994), the DSH gene was hypothesized to be located on chromosome 9, but studies of 3 Japanese families with DSH by Kono et al. (2000) excluded chromosome 9.
Oyama et al. (1999) reported a Japanese family with DSH. The proband was an 11-year-old male, born following a normal pregnancy and delivery. At the age of 1 year, he developed pea-sized pigmented macules on the face. The small hyperpigmented and hypopigmented macules spread gradually on the dorsal aspects of the extremities. The number of skin lesions increased until he was 4 years of age. The mother, a 50-year-old woman, had had an asymptomatic mixture of hyperpigmented and hypopigmented small macules on the backs of her hands and feet as well as scattered small pigmented macules on her face since childhood. Her father, twin brothers of her father, and her grandmother had also had the same skin lesions.
Oyama et al. (1999) reviewed 185 cases of DSH reported since 1923. The differential diagnosis was considered to include dyschromatosis universalis hereditaria (DUH; 127500). DUH was once considered to be a generalized form of DSH; however, Suenaga (1952) pointed out that skin lesions in DUH appear predominantly on the trunk. DSH can closely resemble a mild form of xeroderma pigmentosum (see 278700).
In Italy, Danese et al. (1997) observed a family with affected members in at least 3 generations. The proband was a 21-year-old white woman who had progressive reticulate hyper- and hypopigmentation on the volar surface of the forearms and the dorsa of the hands. There were no pits or breaks in the epidermal ridge pattern on the palms. Urabe and Hori (1997) described a Japanese family with DSH with an autosomal recessive inheritance pattern. Alfadley et al. (2000) described 3 black sibs from the Middle East, a 20-year-old male and his 19- and 18-year-old sisters, who had progressive reticulate hyperpigmented and hypopigmented macules over the dorsa of hands and feet, which began in early childhood. There were no palmar pits or breaks of the epidermal rete ridge pattern, nor was there a family history of any pigmentary skin disease. Findings from 3 skin biopsies from 1 patient were consistent with DSH. These finding suggested to the authors that DSH may be inherited in an autosomal recessive manner.