Sequence 432 (Cthe 1481 , Cthe1481)

From Wikisequences
Jump to: navigation, search
Sequence Cthe_1481 , Cthe1481
Target Cthe_1481 ( Ruminiclostridium thermocellum ATCC 27405 )
Description
Design primer set
Chemistry DNA
Sequence Forward PCR primer (20b) AGTCATATCCGAAAACATGG / Reverse PCR primer (20b) TTGTAGTCGTCAAGGGAAGT
Application gene expression
Name Cthe_1481 , Cthe1481

References

Global transcriptome analysis of Clostridium thermocellum ATCC 27405 during growth on dilute acid pretreated Populus and switchgrass.Wilson CM, Rodriguez M Jr, Johnson CM, Martin SL, Chu TM, Wolfinger RD, Hauser LJ, Land ML, Klingeman DM, Syed MH, Ragauskas AJ, Tschaplinski TJ, Mielenz JR, Brown SD.Biotechnol Biofuels. 2013 Dec 2;6(1) :179. doi: 10.1186/1754-6834-6-179.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Comments

Background

Support Doctors Without Borders