Sequence 433 (Cthe 1604 , Cthe1604)
From Wikisequences
| Sequence Cthe_1604 , Cthe1604 | |
|---|---|
| Target | Cthe_1604 ( Ruminiclostridium thermocellum ATCC 27405 ) |
| Description | |
| Design | primer set |
| Chemistry | DNA |
| Sequence | Forward PCR primer (20b) GTGTCCCCGCTATTGCTAAA / Reverse PCR primer (20b) ATGGGTAAAATGCCGAATGA |
| Application | gene expression |
| Name | Cthe_1604 , Cthe1604 |
References
Global transcriptome analysis of Clostridium thermocellum ATCC 27405 during growth on dilute acid pretreated Populus and switchgrass.Wilson CM, Rodriguez M Jr, Johnson CM, Martin SL, Chu TM, Wolfinger RD, Hauser LJ, Land ML, Klingeman DM, Syed MH, Ragauskas AJ, Tschaplinski TJ, Mielenz JR, Brown SD.Biotechnol Biofuels. 2013 Dec 2;6(1) :179. doi: 10.1186/1754-6834-6-179.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
